Prediction

The maximum number of sgRNA processed in one sequence is limited to 50
Example:
Show Example
CTTTCTTAAAGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTT CTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCT CCCCGCTCCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACC AACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTG CGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGC
Select your FASTA file with exactly 23bps for each sequence and the maximum number of sgRNA processed in one file is limited to 50.
Download Example
Human Sapiens